About   Help   FAQ
D10Mit64 Primer Detail
Primers
  • Name
    D10Mit64
  • Primer 1 Sequence
    TTCCCATTTGGCTATTTCTCC
  • Primer 2 Sequence
    ACACCGTATCATGTGGTCTCTG
  • ID
    MGI:703421
  • Product Size
    166
  • Other IDs
    D10Mit64 (BROAD)
  • Note
    MIT assay: MPC226
    Additional information: MIT STS Marker Data Files
Genes
D10Mit64 DNA segment, Chr 10, Massachusetts Institute of Technology 64
Polymorphisms
J:45743 Zobeley E, et al., Genomics. 1998 Jun 1;50(2):260-6
Notes: The CASA/Rk allele was 2bp larger than the av allele in SSLP analysis.
Endonuclease Gene Allele Fragments Strains
Not Specified D10Mit64 b smaller B6.BKS-Pcdh15av-J
c larger CASA/RkJ
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D10Mit64 a 160bp NOD/MrkTac
b 166bp A/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, LP/J, NON/ShiLt
c 168bp AKR/J, CAST/EiJ
d 170bp SPRET/EiJ
References
J:45743 Zobeley E, et al., Fine genetic and comparative mapping of the deafness mutation Ames waltzer on mouse chromosome 10. Genomics. 1998 Jun 1;50(2):260-6
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory