About   Help   FAQ
D10Mit65 Primer Detail
Primers
  • Name
    D10Mit65
  • Primer 1 Sequence
    TCTGTCTGGTGGCACGGT
  • Primer 2 Sequence
    TTTGTCAGCCAAGTTCCTCC
  • ID
    MGI:703420
  • Product Size
    135
  • Other IDs
    D10Mit65 (BROAD)
  • Note
    MIT assay: MPC213
    Additional information: MIT STS Marker Data Files
Genes
D10Mit65 DNA segment, Chr 10, Massachusetts Institute of Technology 65
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D10Mit65 a 140bp A/J, AKR/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
b 160bp SPRET/EiJ
c 172bp CAST/EiJ
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D10Mit65 l smaller LG/J
s larger SM/J
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D10Mit65 c 189bp CBA/CaOlaHsd
s 191bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory