D10Mit51 Primer Detail MGI Mouse MGI:703405

D10Mit51 Primer Detail

Name

D10Mit51
Primer 1 Sequence

CTTGAGCCTACGTGACCACA
Primer 2 Sequence

TGCAGTCCCTCACACATATACA
ID

MGI:703405
Product Size

149
Note

MIT assay: MPC1302

D10Mit51

DNA segment, Chr 10, Massachusetts Institute of Technology 51

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D10Mit51	b	smaller	C57BL/6J
	D10Mit51	f	larger	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D10Mit51	a	144bp	CAST/EiJ
	b	150bp	B6.Cg-Lep^ob/+, C57BL/6J, NON/ShiLt
	c	154bp	NOD/MrkTac
	d	162bp	A/J, BALB/cJ, C3H/HeJ, DBA/2J, LP/J

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/28/2024 MGI 6.13