About   Help   FAQ
D11Mit327 Primer Detail
Primers
  • Name
    D11Mit327
  • Primer 1 Sequence
    ATTACAGTTGACTGATACCAATCAGC
  • Primer 2 Sequence
    TCAGGCTCCACTGTGAAATG
  • ID
    MGI:703397
  • Product Size
    106
  • Other IDs
    D11Mit327 (BROAD)
  • Note
    MIT assay: MTH1088
    Additional information: MIT STS Marker Data Files
Genes
D11Mit327 DNA Segment, Chr 11, Massachusetts Institute of Technology 327
Polymorphisms
J:39615 Panoutsakopoulou V, et al., Mamm Genome. 1997 May;8(5):357-61
Endonuclease Gene Allele Fragments Strains
Not Specified D11Mit327 a <0.121kb BALB/cByJ
b 0.108kb B10.BR-H2k, B10.D2-H2d, C57BL/6
c 0.121kb BALB.K-H2k, BALB/cAnNCr, BALB/cJ
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D11Mit327 a 108bp B6.Cg-Lepob/+, C57BL/6J
b 114bp CAST/EiJ
c 121bp BALB/cJ, NOD/MrkTac
d 125bp A/J, AKR/J, C3H/HeJ, DBA/2J, LP/J, NON/ShiLt
References
J:39615 Panoutsakopoulou V, et al., Microsatellite typing of CXB recombinant inbred and parental mouse strains. Mamm Genome. 1997 May;8(5):357-61
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support. 		last database update
05/07/2024
MGI 6.23 		The Jackson Laboratory