About   Help   FAQ
D2Mit149 Primer Detail
Primers
  • Name
    D2Mit149
  • Primer 1 Sequence
    ATATCATATAGTAGAGAAAGCGTGCTG
  • Primer 2 Sequence
    TCATTAGACTTGGAAAAAAGTTTGC
  • ID
    MGI:703379
  • Product Size
    199
  • Other IDs
    D2Mit149 (BROAD)
  • Note
    MIT assay: D1193
    Additional information: MIT STS Marker Data Files
Genes
D2Mit149 DNA segment, Chr 2, Massachusetts Institute of Technology 149
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D2Mit149 a 193bp LP/J
b 195bp A/J, AKR/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, NOD/MrkTac, NON/ShiLt
c 197bp DBA/2J
d 209bp CAST/EiJ
e 213bp SPRET/EiJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D2Mit149 c 149bp CBA/CaOlaHsd
s 199bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory