About   Help   FAQ
D15Mit270 Primer Detail
Primers
  • Name
    D15Mit270
  • Primer 1 Sequence
    ATGAGGCTCAATAAGATAAGATGTG
  • Primer 2 Sequence
    GTTGCTACTGTAAATGTCTCCTGTG
  • ID
    MGI:703335
  • Product Size
    200
  • Other IDs
    D15Mit270 (BROAD)
  • Note
    MIT assay: MTH2957
    Additional information: MIT STS Marker Data Files
Genes
D15Mit270 DNA Segment, Chr 15, Massachusetts Institute of Technology 270
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D15Mit270 a 164bp SPRET/EiJ
b 178bp AKR/J
c 180bp BALB/cJ, C3H/HeJ, CAST/EiJ
d 188bp A/J, DBA/2J
e 200bp B6.Cg-Lepob/+, C57BL/6J, LP/J, NOD/MrkTac, NON/ShiLt
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D15Mit270 a 190bp A/JOlaHsd, AKR/OlaHsd
c 180bp BALB/cJ, C3H/HeJ
d 192bp DBA/2J
j 176bp JF1
p 200bp 129P3/J, C57BL/6JOlaHsd, C57BL/10, PWB, SJL/J
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory