About   Help   FAQ
D2Mit297 Primer Detail
Primers
  • Name
    D2Mit297
  • Primer 1 Sequence
    ACTCACCCACCCTCCAAAC
  • Primer 2 Sequence
    CAAGTGCTGGGTTAGCCAAT
  • ID
    MGI:703296
  • Product Size
    144
  • Other IDs
    D2Mit297 (BROAD)
  • Note
    MIT assay: MT1229
    Additional information: MIT STS Marker Data Files
Genes
D2Mit297 DNA segment, Chr 2, Massachusetts Institute of Technology 297
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D2Mit297 a 135bp CAST/EiJ, NON/ShiLt
b 145bp B6.Cg-Lepob/+, BALB/cJ, C57BL/6J
c 147bp A/J, AKR/J, C3H/HeJ, DBA/2J, LP/J
d 151bp SPRET/EiJ
e 153bp NOD/MrkTac
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D2Mit297 c 90bp CBA/CaOlaHsd
s 93bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/21/2024
MGI 6.23
The Jackson Laboratory