About   Help   FAQ
D1Mit18 Primer Detail
Primers
  • Name
    D1Mit18
  • Primer 1 Sequence
    TCTGGTTCCAGGCTTGATTC
  • Primer 2 Sequence
    TCACAAGTGAGGCTCCAGG
  • ID
    MGI:703274
  • Product Size
    156
  • Other IDs
    D1Mit18 (BROAD)
  • Note
    MIT assay: A77
    Additional information: MIT STS Marker Data Files
Genes
D1Mit18 DNA segment, Chr 1, Massachusetts Institute of Technology 18
Polymorphisms
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D1Mit18 m 160bp MOLF/EiJ
s 205bp 129/Sv
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D1Mit18 a 160bp A/J, B6.Cg-Lepob/+, C3H/HeJ, C57BL/6J, DBA/2J, NON/ShiLt
b 170bp AKR/J, BALB/cJ, NOD/MrkTac, SPRET/EiJ
c 180bp CAST/EiJ
d 205bp LP/J
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D1Mit18 a 170bp AKR/W, BALB/cW
b 160bp 129/SvW, A.CA/W, BN/aW, C3H/W, C57BL/6W, C57BL/10W, CBA/W, DBA/2W
References
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory