D6Mit86 Primer Detail MGI Mouse MGI:703270

D6Mit86 Primer Detail

Name

D6Mit86
Primer 1 Sequence

GACCAAACCAGAAGCCCCT
Primer 2 Sequence

GGAATGTAGCCCTAAGTTGGA
ID

MGI:703270
Product Size

132
Other IDs

D6Mit86 (BROAD)
Note

MIT assay: MPC1030
Additional information: MIT STS Marker Data Files

D6Mit86

DNA segment, Chr 6, Massachusetts Institute of Technology 86

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D6Mit86	b	larger	C57BL/6J
	D6Mit86	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D6Mit86	a	114bp	NOD/MrkTac
	b	120bp	A/J, BALB/cJ, C3H/HeJ
	c	122bp	AKR/J, DBA/2J, LP/J, NON/ShiLt
	d	130bp	B6.Cg-Lep^ob/+, C57BL/6J
	e	138bp	CAST/EiJ

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/23/2024 MGI 6.23