About   Help   FAQ
D1Mit14 Primer Detail
Primers
  • Name
    D1Mit14
  • Primer 1 Sequence
    GCCAGACAGGGCTACATTGT
  • Primer 2 Sequence
    AGACTGAACTCTGGCCTCCA
  • ID
    MGI:703261
  • Product Size
    180
  • Other IDs
    D1Mit14 (BROAD)
  • Note
    MIT assay: M193
    Additional information: MIT STS Marker Data Files
Genes
D1Mit14 DNA segment, Chr 1, Massachusetts Institute of Technology 14
Polymorphisms
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D1Mit14 m 190bp MOLF/EiJ
s 205bp 129/Sv
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D1Mit14 a 170bp SPRET/EiJ
b 176bp NOD/MrkTac, NON/ShiLt
c 180bp B6.Cg-Lepob/+, C57BL/6J
d 192bp LP/J
e 196bp CAST/EiJ
f 198bp BALB/cJ
g 202bp A/J, AKR/J, C3H/HeJ, DBA/2J
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D1Mit14 l larger LG/J
s smaller SM/J
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D1Mit14 a 202bp A.CA/W, AKR/W, BALB/cW, C3H/W, CBA/W, DBA/2W
b 180bp 129/SvW, BN/aW, C57BL/6W, C57BL/10W
References
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/07/2024
MGI 6.23
The Jackson Laboratory