D3Mit182 Primer Detail MGI Mouse MGI:703255

D3Mit182 Primer Detail

Name

D3Mit182
Primer 1 Sequence

TTATCTTGTTGGGGAGGTGG
Primer 2 Sequence

AGAGAACTGATTCCTTTAAGTTGTCC
ID

MGI:703255
Product Size

149
Other IDs

D3Mit182 (BROAD)
Note

MIT assay: MMH376
Additional information: MIT STS Marker Data Files

D3Mit182

DNA segment, Chr 3, Massachusetts Institute of Technology 182

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D3Mit182	a	132bp	CAST/EiJ
	b	134bp	AKR/J, DBA/2J, NOD/MrkTac, SPRET/EiJ
	c	136bp	A/J, BALB/cJ, NON/ShiLt
	d	154bp	B6.Cg-Lep^ob/+, C57BL/6J
	e	156bp	C3H/HeJ, LP/J

J:121994 Grzmil P, et al., MGI Direct Data Submission. 2007;

Endonuclease	Gene	Allele	Fragments	Strains
	D3Mit182	c	upper	CBA/Kw
	D3Mit182	e	lower	KE

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

J:121994 Grzmil P, et al., STS markers on chromosome 1, 3, 5, 8 and 9 in CBXE and EXCB recombinant inbred strains of mice. MGI Direct Data Submission. 2007;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/23/2024 MGI 6.23