D3Mit317 Primer Detail MGI Mouse MGI:703244

D3Mit317 Primer Detail

Name

D3Mit317
Primer 1 Sequence

TCCACATGTGCACGCAAG
Primer 2 Sequence

GACAAATATAGAGCATTGGATCCC
ID

MGI:703244
Product Size

124
Other IDs

D3Mit317 (BROAD)
Note

MIT assay: MTH2037
Additional information: MIT STS Marker Data Files

D3Mit317

DNA Segment, Chr 3, Massachusetts Institute of Technology 317

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D3Mit317	a	98bp	DBA/2J
	b	116bp	AKR/J, CAST/EiJ, NOD/MrkTac, NON/ShiLt
	c	124bp	A/J, B6.Cg-Lep^ob/+, C57BL/6J, LP/J
	d	126bp	C3H/HeJ
	e	134bp	SPRET/EiJ

J:121994 Grzmil P, et al., MGI Direct Data Submission. 2007;

Endonuclease	Gene	Allele	Fragments	Strains
	D3Mit317	c	upper	CBA/Kw
	D3Mit317	e	lower	KE

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

J:121994 Grzmil P, et al., STS markers on chromosome 1, 3, 5, 8 and 9 in CBXE and EXCB recombinant inbred strains of mice. MGI Direct Data Submission. 2007;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 10/07/2025 MGI 6.24