About   Help   FAQ
D3Mit317 Primer Detail
Primers
  • Name
    D3Mit317
  • Primer 1 Sequence
    TCCACATGTGCACGCAAG
  • Primer 2 Sequence
    GACAAATATAGAGCATTGGATCCC
  • ID
    MGI:703244
  • Product Size
    124
  • Other IDs
    D3Mit317 (BROAD)
  • Note
    MIT assay: MTH2037
    Additional information: MIT STS Marker Data Files
Genes
D3Mit317 DNA Segment, Chr 3, Massachusetts Institute of Technology 317
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D3Mit317 a 98bp DBA/2J
b 116bp AKR/J, CAST/EiJ, NOD/MrkTac, NON/ShiLt
c 124bp A/J, B6.Cg-Lepob/+, C57BL/6J, LP/J
d 126bp C3H/HeJ
e 134bp SPRET/EiJ
J:121994 Grzmil P, et al., MGI Direct Data Submission. 2007;
Endonuclease Gene Allele Fragments Strains
D3Mit317 c upper CBA/Kw
e lower KE
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
J:121994 Grzmil P, et al., STS markers on chromosome 1, 3, 5, 8 and 9 in CBXE and EXCB recombinant inbred strains of mice. MGI Direct Data Submission. 2007;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory