About   Help   FAQ
D11Mit236 Primer Detail
Primers
  • Name
    D11Mit236
  • Primer 1 Sequence
    TGCCACTTCTTTAATACATGCG
  • Primer 2 Sequence
    AATTTCCTTCTACTCCTCTCTGAGC
  • ID
    MGI:703220
  • Product Size
    104
  • Other IDs
    D11Mit236 (BROAD)
  • Note
    MIT assay: MT4022
    Additional information: MIT STS Marker Data Files
Genes
D11Mit236 DNA segment, Chr 11, Massachusetts Institute of Technology 236
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D11Mit236 a 118bp 129X1/Sv
f 84bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D11Mit236 a 84bp AKR/J, DBA/2J, NOD/MrkTac
b 90bp NON/ShiLt
c 92bp CAST/EiJ
d 106bp B6.Cg-Lepob/+, C57BL/6J
e 108bp A/J, C3H/HeJ, SPRET/EiJ
f 112bp LP/J
g 118bp BALB/cJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D11Mit236 c 149bp CBA/CaOlaHsd
s 129bp SWR/OlaHsd
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory