About   Help   FAQ
D17Mit63 Primer Detail
Primers
  • Name
    D17Mit63
  • Primer 1 Sequence
    CTAGGTCCATTTCCTTGGCA
  • Primer 2 Sequence
    CCACACCCATGGCATGAC
  • ID
    MGI:703216
  • Product Size
    129
  • Other IDs
    D17Mit63 (BROAD)
  • Note
    MIT assay: MPC1645
    Additional information: MIT STS Marker Data Files
Genes
D17Mit63 DNA segment, Chr 17, Massachusetts Institute of Technology 63
Polymorphisms
J:23589 Vernet C, et al., Mamm Genome. 1995 Mar;6(3):219-21
Endonuclease Gene Allele Fragments Strains
Not Specified D17Mit63 a smallest STOCK t12
b larger STOCK tw5
c largest C3H
d large STOCK tw12
J:44833 Meagher S, et al., Hereditas. 1997;127(1-2):75-82
Endonuclease Gene Allele Fragments Strains
Not Specified D17Mit63 a smallest M. caroli
b larger CAST/EiJ, P/J
c larger than above C57BL/6J, DBA/2J, RIIIS/J, SM/J
d larger than above A.CA-H2f/Sn, CBA/J, SJL/J, SWR/J
e larger than above M. spretus
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D17Mit63 a 126bp CAST/EiJ, NOD/MrkTac
b 130bp B6.Cg-Lepob/+, BALB/cJ, C57BL/6J, DBA/2J, LP/J, NON/ShiLt
c 132bp A/J, AKR/J, C3H/HeJ
d 140bp SPRET/EiJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D17Mit63 c 135bp CBA/CaOlaHsd
s 131bp SWR/OlaHsd
References
J:23589 Vernet C, et al., Mapping of 12 markers in the proximal region of mouse chromosome 17 using recombinant t haplotypes. Mamm Genome. 1995 Mar;6(3):219-21
J:44833 Meagher S, et al., A microsatellite-based MHC genotyping system for house mice (Mus domesticus). Hereditas. 1997;127(1-2):75-82
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory