About   Help   FAQ
D17Mit62 Primer Detail
Primers
  • Name
    D17Mit62
  • Primer 1 Sequence
    CCACATCTTCTAATCCTGCTCA
  • Primer 2 Sequence
    CATATAGCCTGAGACATTCTGCC
  • ID
    MGI:703215
  • Product Size
    172
  • Other IDs
    D17Mit62 (BROAD)
  • Note
    MIT assay: MPC1728
    Additional information: MIT STS Marker Data Files
Genes
D17Mit62 DNA segment, Chr 17, Massachusetts Institute of Technology 62
Polymorphisms
J:23589 Vernet C, et al., Mamm Genome. 1995 Mar;6(3):219-21
Endonuclease Gene Allele Fragments Strains
Not Specified D17Mit62 a smallest STOCK t12
b larger STOCK tw5
c large C3H, STOCK tw12
J:44833 Meagher S, et al., Hereditas. 1997;127(1-2):75-82
Endonuclease Gene Allele Fragments Strains
Not Specified D17Mit62 a smallest DBA/2J
b larger P/J
c larger than above M. spretus
d larger than above A.CA-H2f/Sn, CBA/J
e larger than above RIIIS/J
f larger than above SJL/J, SM/J
g larger than above C57BL/6J
h larger than above SWR/J
i larger than above M. caroli
j larger than above CAST/EiJ
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D17Mit62 a 158bp BALB/cJ, DBA/2J
b 162bp SPRET/EiJ
c 166bp A/J, AKR/J, C3H/HeJ
d 174bp B6.Cg-Lepob/+, C57BL/6J, LP/J, NON/ShiLt
e 176bp NOD/MrkTac
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D17Mit62 a 174bp 129/SvW, C57BL/6W, C57BL/10W
b 166bp AKR/W, BN/aW
c 158bp A.CA/W, BALB/cW, C3H/W, CBA/W, DBA/2W
References
J:23589 Vernet C, et al., Mapping of 12 markers in the proximal region of mouse chromosome 17 using recombinant t haplotypes. Mamm Genome. 1995 Mar;6(3):219-21
J:44833 Meagher S, et al., A microsatellite-based MHC genotyping system for house mice (Mus domesticus). Hereditas. 1997;127(1-2):75-82
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory