About   Help   FAQ
D17Mit67 Primer Detail
Primers
  • Name
    D17Mit67
  • Primer 1 Sequence
    TGTGGAAGAGTGCTGGCTC
  • Primer 2 Sequence
    GATACTGTCTGTATCTCCCCAGTG
  • ID
    MGI:703212
  • Product Size
    140
  • Other IDs
    D17Mit67 (BROAD)
  • Note
    MIT assay: MPC854
    Additional information: MIT STS Marker Data Files
Genes
D17Mit67 DNA segment, Chr 17, Massachusetts Institute of Technology 67
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D17Mit67 a 126bp NON/ShiLt
b 128bp CAST/EiJ, NOD/MrkTac
c 142bp B6.Cg-Lepob/+, C57BL/6J
d 144bp AKR/J, BALB/cJ, C3H/HeJ, DBA/2J
e 148bp LP/J, SPRET/EiJ
J:66472 Matsune K, J Oral Sci. 2000 Mar;42(1):21-6
Endonuclease Gene Allele Fragments Strains
D17Mit67 b larger C57BL/6J
l smaller C57L/J
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:66472 Matsune K, Molecular genetic study of the gutter shaped root (GSR) on mouse chromosome 17. J Oral Sci. 2000 Mar;42(1):21-6
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory