About   Help   FAQ
D17Mit66 Primer Detail
Primers
  • Name
    D17Mit66
  • Primer 1 Sequence
    GGCTTCCACACATGATTGC
  • Primer 2 Sequence
    TTCTGGGTCCATCATCACAA
  • ID
    MGI:703211
  • Product Size
    131
  • Other IDs
    D17Mit66 (BROAD)
  • Note
    MIT assay: MPC858
    Additional information: MIT STS Marker Data Files
Genes
D17Mit66 DNA segment, Chr 17, Massachusetts Institute of Technology 66
Polymorphisms
J:39615 Panoutsakopoulou V, et al., Mamm Genome. 1997 May;8(5):357-61
Endonuclease Gene Allele Fragments Strains
Not Specified D17Mit66 b 0.132kb B10.BR-H2k, C57BL/6
c 0.108kb B10.D2-H2d, BALB.K-H2k, BALB/cAnNCr, BALB/cByJ, BALB/cJ
J:46489 You Y, et al., Mamm Genome. 1998 Mar;9(3):232-4
Notes: Data for C57BL/6J and BALB/cJ strains was derived from the Whitehead Institute/MIT genome center website.
Endonuclease Gene Allele Fragments Strains
Not Specified D17Mit66 b 132bp C57BL/6J
c 108bp BALB/cJ
s 125bp 129X1/SvJ
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D17Mit66 a 108bp A/J, AKR/J, BALB/cJ, C3H/HeJ, DBA/2J
b 112bp CAST/EiJ
c 124bp NON/ShiLt
d 132bp B6.Cg-Lepob/+, C57BL/6J
e 138bp NOD/MrkTac
References
J:39615 Panoutsakopoulou V, et al., Microsatellite typing of CXB recombinant inbred and parental mouse strains. Mamm Genome. 1997 May;8(5):357-61
J:46489 You Y, et al., Utility of C57BL/6J x 129/SvJae embryonic stem cells for generating chromosomal deletions: tolerance to gamma radiation and microsatellite polymorphism. Mamm Genome. 1998 Mar;9(3):232-4
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/13/2026
MGI 6.24
The Jackson Laboratory