About   Help   FAQ
D17Mit64 Primer Detail
Primers
  • Name
    D17Mit64
  • Primer 1 Sequence
    CCAATTTCATTCAATTTACCACA
  • Primer 2 Sequence
    TTAGATGCTAGCACATATCAAAATACA
  • ID
    MGI:703209
  • Product Size
    144
  • Note
    MIT assay: MPC2153
Genes
D17Mit64 DNA segment, Chr 17, Massachusetts Institute of Technology 64
Polymorphisms
J:23589 Vernet C, et al., Mamm Genome. 1995 Mar;6(3):219-21
Endonuclease Gene Allele Fragments Strains
Not Specified D17Mit64 a larger STOCK t12
b large STOCK tw5, STOCK tw12
c smallest C3H
J:39182 Xiao H, et al., Immunogenetics. 1997;45(4):274-7
Endonuclease Gene Allele Fragments Strains
Not Specified D17Mit64 a small B10.CAS3
b medium C3H/HeJ
c large B10.CAS4, C3.SW-H2b
d larger C57BL/6, C57BL/10
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D17Mit64 a 128bp SPRET/EiJ
b 136bp AKR/J, BALB/cJ, C3H/HeJ, DBA/2J
c 138bp CAST/EiJ
d 142bp LP/J
e 144bp B6.Cg-Lepob/+, C57BL/6J
f 146bp A/J, NOD/MrkTac, NON/ShiLt
References
J:23589 Vernet C, et al., Mapping of 12 markers in the proximal region of mouse chromosome 17 using recombinant t haplotypes. Mamm Genome. 1995 Mar;6(3):219-21
J:39182 Xiao H, et al., Fine mapping of 12 microsatellites and two new recombinants in the distal H2 complex on mouse chromosome 17. Immunogenetics. 1997;45(4):274-7
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory