D17Mit64 Primer Detail MGI Mouse MGI:703209

D17Mit64 Primer Detail

Name

D17Mit64
Primer 1 Sequence

CCAATTTCATTCAATTTACCACA
Primer 2 Sequence

TTAGATGCTAGCACATATCAAAATACA
ID

MGI:703209
Product Size

144
Note

MIT assay: MPC2153

D17Mit64

DNA segment, Chr 17, Massachusetts Institute of Technology 64

J:23589 Vernet C, et al., Mamm Genome. 1995 Mar;6(3):219-21

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D17Mit64	a	larger	STOCK t¹²
		b	large	STOCK t^w5, STOCK t^w12
		c	smallest	C3H

J:39182 Xiao H, et al., Immunogenetics. 1997;45(4):274-7

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D17Mit64	a	small	B10.CAS3
		b	medium	C3H/HeJ
		c	large	B10.CAS4, C3.SW-H2^b
		d	larger	C57BL/6, C57BL/10

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D17Mit64	a	128bp	SPRET/EiJ
	b	136bp	AKR/J, BALB/cJ, C3H/HeJ, DBA/2J
	c	138bp	CAST/EiJ
	d	142bp	LP/J
	e	144bp	B6.Cg-Lep^ob/+, C57BL/6J
	f	146bp	A/J, NOD/MrkTac, NON/ShiLt

J:23589 Vernet C, et al., Mapping of 12 markers in the proximal region of mouse chromosome 17 using recombinant t haplotypes. Mamm Genome. 1995 Mar;6(3):219-21

J:39182 Xiao H, et al., Fine mapping of 12 microsatellites and two new recombinants in the distal H2 complex on mouse chromosome 17. Immunogenetics. 1997;45(4):274-7

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24