About   Help   FAQ
D17Mit68 Primer Detail
Primers
  • Name
    D17Mit68
  • Primer 1 Sequence
    GTCCTGACATCATGCTTTGTG
  • Primer 2 Sequence
    CTACCGTTTGGAAGGCTGAG
  • ID
    MGI:703206
  • Product Size
    130
  • Other IDs
    D17Mit68 (BROAD)
  • Note
    MIT assay: MPC186
    Additional information: MIT STS Marker Data Files
Genes
D17Mit68 DNA segment, Chr 17, Massachusetts Institute of Technology 68
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D17Mit68 a 134bp B6.Cg-Lepob/+, C57BL/6J
b 138bp LP/J
c 140bp A/J, C3H/HeJ, DBA/2J, NON/ShiLt
d 146bp AKR/J, BALB/cJ
e 150bp SPRET/EiJ
f 155bp CAST/EiJ
g 172bp NOD/MrkTac
J:90435 Golas A, et al., MGI Direct Data Submission. 2004;
Endonuclease Gene Allele Fragments Strains
D17Mit68 c smaller CBA/Kw
e larger KE
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory