About   Help   FAQ
D4Mit306 Primer Detail
Primers
  • Name
    D4Mit306
  • Primer 1 Sequence
    CCACTATTGCTGCCACCAC
  • Primer 2 Sequence
    TAAAAACAGGACATCGCTAATAAGG
  • ID
    MGI:703204
  • Product Size
    120
  • Other IDs
    D4Mit306 (BROAD)
  • Note
    MIT assay: MTH2027
    Additional information: MIT STS Marker Data Files
Genes
D4Mit306 DNA Segment, Chr 4, Massachusetts Institute of Technology 306
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D4Mit306 a 114bp AKR/J, NON/ShiLt
b 118bp CAST/EiJ, SPRET/EiJ
c 122bp A/J, B6.Cg-Lepob/+, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac
d 128bp BALB/cJ
J:90435 Golas A, et al., MGI Direct Data Submission. 2004;
Endonuclease Gene Allele Fragments Strains
D4Mit306 c smaller CBA/Kw
e larger KE
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/07/2025
MGI 6.24
The Jackson Laboratory