About   Help   FAQ
D12Mit157 Primer Detail
Primers
  • Name
    D12Mit157
  • Primer 1 Sequence
    TGAGCGTGCGCGTTATAC
  • Primer 2 Sequence
    AGGTTAATATCCTGACCATCACC
  • ID
    MGI:703194
  • Product Size
    159
  • Note
    MIT assay: MT1827
Genes
D12Mit157 DNA segment, Chr 12, Massachusetts Institute of Technology 157
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D12Mit157 a 136bp CAST/EiJ
b 138bp SPRET/EiJ
c 148bp A/J, C3H/HeJ, DBA/2J, NOD/MrkTac, NON/ShiLt
d 150bp AKR/J
e 160bp B6.Cg-Lepob/+, BALB/cJ, C57BL/6J, LP/J
J:156851 Golas A, MGI Direct Data Submission. 2010;
Endonuclease Gene Allele Fragments Strains
D12Mit157 b lower C57BL/6J
s upper 129/Sv
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
J:156851 Golas A, Microsatellite differences on Chromosome 3, 6, 11 and 12 in C57BL/6J and 129/Sv strains and Mapping in CBXE RI line. MGI Direct Data Submission. 2010;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory