About   Help   FAQ
D12Mit19 Primer Detail
Primers
  • Name
    D12Mit19
  • Primer 1 Sequence
    GCTTCTTTTTTCTAGAGACCATGA
  • Primer 2 Sequence
    GGAGGTAGAAGGCTGTACATGG
  • ID
    MGI:703193
  • Product Size
    245
  • Note
    MIT assay: D602
Genes
D12Mit19 DNA segment, Chr 12, Massachusetts Institute of Technology 19
Polymorphisms
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D12Mit19 m 351bp MOLF/EiJ
s 343bp 129/Sv
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D12Mit19 a 304bp DBA/2J
b 316bp SPRET/EiJ
c 318bp AKR/J
d 324bp A/J
e 334bp C3H/HeJ, NON/ShiLt
f 338bp LP/J, NOD/MrkTac
g 340bp BALB/cJ
h 344bp B6.Cg-Lepob/+
i 346bp C57BL/6J
j 352bp CAST/EiJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D12Mit19 c 133bp CBA/CaOlaHsd
s 128bp SWR/OlaHsd
References
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory