D12Mit11 Primer Detail MGI Mouse MGI:703185

D12Mit11 Primer Detail

Name

D12Mit11
Primer 1 Sequence

TCCCAAATGGAAGACAGGAA
Primer 2 Sequence

CCCTCCCATTGCCTTTTAAT
ID

MGI:703185
Product Size

143
Other IDs

D12Mit11 (BROAD)
Note

MIT assay: B250
Additional information: MIT STS Marker Data Files

D12Mit11

DNA segment, Chr 12, Massachusetts Institute of Technology 11

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D12Mit11	c	166bp	C3HeB/FeJLe
	D12Mit11	f	larger	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D12Mit11	a	142bp	CAST/EiJ
	b	146bp	SPRET/EiJ
	c	164bp	NOD/MrkTac
	d	166bp	C3H/HeJ
	e	170bp	A/J, BALB/cJ
	f	172bp	B6.Cg-Lep^ob/+, C57BL/6J
	g	176bp	LP/J, NON/ShiLt
	h	178bp	AKR/J
	i	182bp	DBA/2J

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D12Mit11	c	128bp	CBA/CaOlaHsd
	D12Mit11	s	123bp	SWR/OlaHsd

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 10/07/2025 MGI 6.24