About   Help   FAQ
D12Mit11 Primer Detail
Primers
  • Name
    D12Mit11
  • Primer 1 Sequence
    TCCCAAATGGAAGACAGGAA
  • Primer 2 Sequence
    CCCTCCCATTGCCTTTTAAT
  • ID
    MGI:703185
  • Product Size
    143
  • Other IDs
    D12Mit11 (BROAD)
  • Note
    MIT assay: B250
    Additional information: MIT STS Marker Data Files
Genes
D12Mit11 DNA segment, Chr 12, Massachusetts Institute of Technology 11
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D12Mit11 c 166bp C3HeB/FeJLe
f larger FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D12Mit11 a 142bp CAST/EiJ
b 146bp SPRET/EiJ
c 164bp NOD/MrkTac
d 166bp C3H/HeJ
e 170bp A/J, BALB/cJ
f 172bp B6.Cg-Lepob/+, C57BL/6J
g 176bp LP/J, NON/ShiLt
h 178bp AKR/J
i 182bp DBA/2J
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D12Mit11 c 128bp CBA/CaOlaHsd
s 123bp SWR/OlaHsd
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory