About   Help   FAQ
DXMit99 Primer Detail
Primers
  • Name
    DXMit99
  • Primer 1 Sequence
    GGAATTCAACAAAAGGTATGTGC
  • Primer 2 Sequence
    ACCTGTCTCCTTTCCTCTCTCC
  • ID
    MGI:703177
  • Product Size
    148
  • Other IDs
    DXMit99 (BROAD)
  • Note
    MIT assay: MT1569
    Additional information: MIT STS Marker Data Files
Genes
DXMit99 DNA segment, Chr X, Massachusetts Institute of Technology 99
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
DXMit99 a 145bp C3H/HeJ
b 147bp CAST/EiJ
c 149bp AKR/J, B6.Cg-Lepob/+, C57BL/6J, DBA/2J, LP/J, NON/ShiLt
d 151bp NOD/MrkTac
e 153bp BALB/cJ
f 157bp SPRET/EiJ
g 161bp A/J
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
DXMit99 c 167bp CBA/CaOlaHsd
s 156bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory