About   Help   FAQ
DXMit95 Primer Detail
Primers
  • Name
    DXMit95
  • Primer 1 Sequence
    CTGTCAATCTAATTCTCTATGTCTGTG
  • Primer 2 Sequence
    CTTTCCTGGGTGGCAGTG
  • ID
    MGI:703174
  • Product Size
    150
  • Other IDs
    DXMit95 (BROAD)
  • Note
    MIT assay: MT1537
    Additional information: MIT STS Marker Data Files
Genes
DXMit95a DNA segment, Chr X, Massachusetts Institute of Technology 95a
DXMit95b DNA segment, Chr X, Massachusetts Institute of Technology 95b
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
DXMit95a a 135bp SPRET/EiJ
b 137bp DBA/2J, NOD/MrkTac
c 141bp AKR/J
d 147bp NON/ShiLt
e 151bp A/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, LP/J
f 157bp CAST/EiJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
DXMit95a c 149bp CBA/CaOlaHsd
s 145bp SWR/OlaHsd
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
DXMit95a a 151bp 129/SvW, A.CA/W, BALB/cW, BN/aW, C3H/W, C57BL/6W, C57BL/10W, CBA/W
b 145bp AKR/W
c 137bp DBA/2W
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory