D5Mit391 Primer Detail MGI Mouse MGI:703173

D5Mit391 Primer Detail

Name

D5Mit391
Primer 1 Sequence

AATAAGAAAATTCCACCAAGTCTACA
Primer 2 Sequence

CTTGATGGGTCTGATGCCTT
ID

MGI:703173
Product Size

148
Other IDs

D5Mit391 (BROAD)
Note

MIT assay: MTH2688
Additional information: MIT STS Marker Data Files

D5Mit391

DNA Segment, Chr 5 Massachusetts Institute of Technology 391

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D5Mit391	a	148bp	B6.Cg-Lep^ob/+, C57BL/6J
	b	160bp	BALB/cJ
	c	174bp	SPRET/EiJ
	d	178bp	A/J, AKR/J, C3H/HeJ, CAST/EiJ, DBA/2J, LP/J, NOD/MrkTac

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D5Mit391	a	178bp	A.CA/W, AKR/W, BN/aW, C3H/W, CBA/W, DBA/2W
	b	160bp	129/SvW, BALB/cW
	c	148bp	C57BL/6W, C57BL/10W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/21/2024 MGI 6.23