D1Mit211 Primer Detail MGI Mouse MGI:703163

D1Mit211 Primer Detail

Name

D1Mit211
Primer 1 Sequence

GTTATTCATCAAAATACAGATGGCC
Primer 2 Sequence

TCTGCTGCTAAGTAGAATGAATGC
ID

MGI:703163
Product Size

135
Other IDs

D1Mit211 (BROAD)
Note

MIT assay: MT1322
Additional information: MIT STS Marker Data Files

D1Mit211

DNA segment, Chr 1, Massachusetts Institute of Technology 211

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D1Mit211	a	116bp	SPRET/EiJ
	b	139bp	B6.Cg-Lep^ob/+, C57BL/6J
	c	146bp	A/J, C3H/HeJ, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
	d	147bp	CAST/EiJ
	e	149bp	AKR/J, BALB/cJ

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D1Mit211	b	134bp	C57BL/6JOlaHsd, C57BL/10, SJL/J
	c	146bp	AKR/OlaHsd, BALB/cJ
	d	142bp	129P3/J, A/JOlaHsd, C3H/HeJ, DBA/2J
	j	150bp	JF1
	p	130bp	PWB

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D1Mit211	c	147bp	CBA/CaOlaHsd
	D1Mit211	s	137bp	SWR/OlaHsd

J:71432 Schwarz M, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D1Mit211	a	larger	129P3/J
	D1Mit211	s	smaller	SJL/J

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:71432 Schwarz M, Polymorphisms between 129P3/J and SJL/J. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24