About   Help   FAQ
D1Mit216 Primer Detail
Primers
  • Name
    D1Mit216
  • Primer 1 Sequence
    GGGAGACAACAAATAATCATATTGC
  • Primer 2 Sequence
    AGAGGTGGGTCCTGGAAACT
  • ID
    MGI:703156
  • Product Size
    120
  • Other IDs
    D1Mit216 (BROAD)
  • Note
    MIT assay: MT585
    Additional information: MIT STS Marker Data Files
Genes
D1Mit216 DNA segment, Chr 1, Massachusetts Institute of Technology 216
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D1Mit216 a 121bp LP/J, NON/ShiLt
b 123bp AKR/J, B6.Cg-Lepob/+, C57BL/6J
c 125bp A/J, BALB/cJ, C3H/HeJ
d 129bp DBA/2J, NOD/MrkTac
e 135bp CAST/EiJ
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D1Mit216 a 118bp AKR/OlaHsd, C57BL/6JOlaHsd, C57BL/10
c 120bp A/JOlaHsd, BALB/cJ, C3H/HeJ, SJL/J
d 124bp DBA/2J
g 116bp 129P3/J
j 94bp JF1
p 98bp PWB
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory