About   Help   FAQ
D5Mit6 Primer Detail
Primers
  • Name
    D5Mit6
  • Primer 1 Sequence
    CTCCAAATGGAACTATGGAA
  • Primer 2 Sequence
    CATGATATTAAGCAGCTGTG
  • ID
    MGI:703143
  • Product Size
    135
  • Other IDs
    D5Mit6 (BROAD)
  • Note
    MIT assay: L42
    Additional information: MIT STS Marker Data Files
Genes
D5Mit6 DNA segment, Chr 5, Massachusetts Institute of Technology 6
Polymorphisms
J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9
Endonuclease Gene Allele Fragments Strains
Not Specified D5Mit6 a largest C57BL/6, DBA/2
b smaller JF1, MSM/Ms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D5Mit6 a 108bp SPRET/EiJ
b 123bp CAST/EiJ
c 129bp LP/J
d 133bp A/J, AKR/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, NOD/MrkTac, NON/ShiLt
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D5Mit6 l smaller LG/J
s larger SM/J
References
J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory