D5Mit4 Primer Detail MGI Mouse MGI:703141

D5Mit4 Primer Detail

Name

D5Mit4
Primer 1 Sequence

CTAGTCATTGGCTCCAAGGG
Primer 2 Sequence

ATGCACTGGGAGAGTGAAGG
ID

MGI:703141
Product Size

198
Other IDs

D5Mit4 (BROAD)
Note

MIT assay: M189
Additional information: MIT STS Marker Data Files

D5Mit4

DNA segment, Chr 5, Massachusetts Institute of Technology 4

J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D5Mit4	a	largest	JF1, MSM/Ms
Not Specified	D5Mit4	b	smaller	C57BL/6, DBA/2

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D5Mit4	a	195bp	A/J, AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
	b	238bp	CAST/EiJ
	c	250bp	SPRET/EiJ

J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/28/2024 MGI 6.13