About   Help   FAQ
D5Mit1 Primer Detail
Primers
  • Name
    D5Mit1
  • Primer 1 Sequence
    AATAAAGCTGTGAGGTAAACCCC
  • Primer 2 Sequence
    GAAACAAATGATTGTTTTGAGCC
  • ID
    MGI:703138
  • Product Size
    137
  • Other IDs
    D5Mit1 (BROAD)
  • Note
    MIT assay: A82
    Additional information: MIT STS Marker Data Files
Genes
D5Mit1 DNA segment, Chr 5, Massachusetts Institute of Technology 1
Polymorphisms
J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9
Endonuclease Gene Allele Fragments Strains
Not Specified D5Mit1 a largest JF1
b smaller MSM/Ms
c smaller C57BL/6
d smallest DBA/2
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D5Mit1 m 135bp MOLF/EiJ
s 155bp 129/Sv
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D5Mit1 a 127bp AKR/J, DBA/2J, LP/J
b 135bp A/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, NOD/MrkTac, NON/ShiLt
c 143bp CAST/EiJ
d 147bp SPRET/EiJ
References
J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory