About   Help   FAQ
D19Mit10 Primer Detail
Primers
  • Name
    D19Mit10
  • Primer 1 Sequence
    GCCTTTAAGCCAGTCAAGACA
  • Primer 2 Sequence
    CCAGTCTGGACTTGTGAATGA
  • ID
    MGI:703131
  • Product Size
    150
  • Other IDs
    D19Mit10 (BROAD)
  • Note
    MIT assay: B118
    Additional information: MIT STS Marker Data Files
Genes
D19Mit10 DNA segment, Chr 19, Massachusetts Institute of Technology 10
Polymorphisms
J:41506 Casteels D, et al., Mouse Genome. 1997;95(2):488-91
Endonuclease Gene Allele Fragments Strains
Not Specified D19Mit10 b 190bp BALB/c
c 130bp CF-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D19Mit10 a 130bp AKR/J, NOD/MrkTac, NON/ShiLt
b 146bp C3H/HeJ
c 152bp B6.Cg-Lepob/+, C57BL/6J
d 190bp BALB/cJ, LP/J
e 194bp A/J, DBA/2J
f 260bp CAST/EiJ
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D19Mit10 a 126bp AKR/OlaHsd
b 150bp C57BL/6JOlaHsd, C57BL/10
c 188bp A/JOlaHsd, BALB/cJ
d 186bp DBA/2J
g 184bp 129P3/J
h 144bp C3H/HeJ
l 140bp SJL/J
p 228bp JF1, PWB
J:90435 Golas A, et al., MGI Direct Data Submission. 2004;
Endonuclease Gene Allele Fragments Strains
D19Mit10 c smaller CBA/Kw
e larger KE
References
J:41506 Casteels D, et al., Characterization and Chromosomal localization of a strain-specific mouse FAU retropseudogene. Mouse Genome. 1997;95(2):488-91
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory