D19Mit11 Primer Detail MGI Mouse MGI:703130

D19Mit11 Primer Detail

Name

D19Mit11
Primer 1 Sequence

TCAAAGTCAAGGTGGGCAG
Primer 2 Sequence

ACTTTCCAGATGTTGGGCAC
ID

MGI:703130
Product Size

146
Other IDs

D19Mit11 (BROAD)
Note

MIT assay: B281
Additional information: MIT STS Marker Data Files

DNA segment, Chr 19, Massachusetts Institute of Technology 11.1

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D19Mit11.1	a	150bp	129P2/Ola, 129P3/J, 129T1/Sv-Dnd1^Ter, 129X1/Sv
		b	138bp	129X1/SvJ
		c	146, 150bp	CD-1

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D19Mit11.1	b	smaller	C57BL/6J
	D19Mit11.1	f	larger	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D19Mit11.1	a	118bp	CAST/EiJ
	b	146bp	B6.Cg-Lep^ob/+, C57BL/6J, NON/ShiLt
	c	150bp	BALB/cJ, DBA/2J, NOD/MrkTac
	d	164bp	AKR/J, C3H/HeJ, LP/J
	e	216bp	SPRET/EiJ

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D19Mit11.1	a	160bp	129/SvW, A.CA/W, AKR/W, BN/aW, C3H/W, CBA/W
	b	150bp	BALB/cW, DBA/2W
	c	144bp	C57BL/6W, C57BL/10W

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/14/2024 MGI 6.23