About   Help   FAQ
D19Mit11 Primer Detail
Primers
  • Name
    D19Mit11
  • Primer 1 Sequence
    TCAAAGTCAAGGTGGGCAG
  • Primer 2 Sequence
    ACTTTCCAGATGTTGGGCAC
  • ID
    MGI:703130
  • Product Size
    146
  • Other IDs
    D19Mit11 (BROAD)
  • Note
    MIT assay: B281
    Additional information: MIT STS Marker Data Files
Genes
D19Mit11.1 DNA segment, Chr 19, Massachusetts Institute of Technology 11.1
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D19Mit11.1 a 150bp 129P2/Ola, 129P3/J, 129T1/Sv-Dnd1Ter, 129X1/Sv
b 138bp 129X1/SvJ
c 146, 150bp CD-1
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D19Mit11.1 b smaller C57BL/6J
f larger FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D19Mit11.1 a 118bp CAST/EiJ
b 146bp B6.Cg-Lepob/+, C57BL/6J, NON/ShiLt
c 150bp BALB/cJ, DBA/2J, NOD/MrkTac
d 164bp AKR/J, C3H/HeJ, LP/J
e 216bp SPRET/EiJ
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D19Mit11.1 a 160bp 129/SvW, A.CA/W, AKR/W, BN/aW, C3H/W, CBA/W
b 150bp BALB/cW, DBA/2W
c 144bp C57BL/6W, C57BL/10W
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory