About   Help   FAQ
D19Mit12 Primer Detail
Primers
  • Name
    D19Mit12
  • Primer 1 Sequence
    TGCATATGTTTTCTCAAATGTGG
  • Primer 2 Sequence
    GTTCCCACCACACCTTTATACC
  • ID
    MGI:703129
  • Product Size
    147
  • Other IDs
    D19Mit12 (BROAD)
  • Note
    MIT assay: B416
    Additional information: MIT STS Marker Data Files
Genes
D19Mit12 DNA segment, Chr 19, Massachusetts Institute of Technology 12
Polymorphisms
J:45418 Hansen GM, et al., Mamm Genome. 1998 Jan;9(1):88-90
Endonuclease Gene Allele Fragments Strains
Not Specified D19Mit12 l 0.15kb SB/LeJ
s 0.12kb M. spretus
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D19Mit12 a 124bp SPRET/EiJ
b 150bp A/J, AKR/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
c 152bp CAST/EiJ
References
J:45418 Hansen GM, et al., Pten, a candidate tumor suppressor gene, maps to mouse chromosome 19. Mamm Genome. 1998 Jan;9(1):88-90
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory