D19Mit13 Primer Detail MGI Mouse MGI:703128

D19Mit13 Primer Detail

Name

D19Mit13
Primer 1 Sequence

TCTGGCACAAAGAGTTCGTG
Primer 2 Sequence

CTTTTGCAGGAGCAGGTAGG
ID

MGI:703128
Product Size

248
Other IDs

D19Mit13 (BROAD)
Note

MIT assay: A871
Additional information: MIT STS Marker Data Files

D19Mit13

DNA segment, Chr 19, Massachusetts Institute of Technology 13

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D19Mit13	b	smaller	C57BL/6J
	D19Mit13	f	larger	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D19Mit13	a	246bp	A/J, AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J, LP/J, NOD/MrkTac, NON/ShiLt
	b	248bp	CAST/EiJ
	c	262bp	C3H/HeJ, DBA/2J
	d	288bp	SPRET/EiJ

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D19Mit13	a	270bp	C3H/W, DBA/2W
	b	260bp	129/SvW, A.CA/W, BN/aW, CBA/W
	c	246bp	AKR/W, BALB/cW, C57BL/6W, C57BL/10W

J:90435 Golas A, et al., MGI Direct Data Submission. 2004;

Endonuclease	Gene	Allele	Fragments	Strains
	D19Mit13	c	larger	CBA/Kw
	D19Mit13	e	smaller	KE

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/14/2024 MGI 6.23