About   Help   FAQ
D7Mit246 Primer Detail
Primers
  • Name
    D7Mit246
  • Primer 1 Sequence
    CACACAAAGCCGCAGTTCTA
  • Primer 2 Sequence
    TTGTTACGTGGCCTAGATTGG
  • ID
    MGI:703121
  • Product Size
    137
  • Other IDs
    D7Mit246 (BROAD)
  • Note
    MIT assay: MT3702
    Additional information: MIT STS Marker Data Files
Genes
D7Mit246 DNA segment, Chr 7, Massachusetts Institute of Technology 246
Polymorphisms
J:40661 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):390-3
Endonuclease Gene Allele Fragments Strains
Not Specified D7Mit246 a 136bp 129P1/ReJ, 129P2/Ola, 129P3/J, 129P4/RrRkJ, 129S/SvEv, 129T1/Sv-Dnd1Ter, 129X1/Sv, 129X1/SvJ, C57BL/6J
b 142bp C3HeB/FeJ
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D7Mit246 a 136bp 129X1/Sv
f 123, 125bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D7Mit246 a 126bp SPRET/EiJ
b 136bp B6.Cg-Lepob/+, C3H/HeJ, C57BL/6J
c 138bp AKR/J
d 140bp NOD/MrkTac, NON/ShiLt
e 168bp CAST/EiJ
f 170bp BALB/cJ, LP/J
g 172bp DBA/2J
h 174bp A/J
J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3
Endonuclease Gene Allele Fragments Strains
D7Mit246 c larger C58/J
f not given FVB/NJ
i larger I/LnJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D7Mit246 c 134bp CBA/CaOlaHsd
s 126bp SWR/OlaHsd
References
J:40661 Threadgill DW, et al., Genealogy of the 129 inbred strains: 129/SvJ is a contaminated inbred strain. Mamm Genome. 1997 Jun;8(6):390-3
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory