About   Help   FAQ
D18Mit150 Primer Detail
Primers
  • Name
    D18Mit150
  • Primer 1 Sequence
    CAACTGGAGAAAGTGCTGAGG
  • Primer 2 Sequence
    TCCTTCTGTGATATTTCCTAAGCC
  • ID
    MGI:703102
  • Product Size
    139
  • Other IDs
    D18Mit150 (BROAD)
  • Note
    MIT assay: MT3220
    Additional information: MIT STS Marker Data Files
Genes
D18Mit150 DNA segment, Chr 18, Massachusetts Institute of Technology 150
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D18Mit150 a 136bp A/J
b 138bp B6.Cg-Lepob/+, LP/J
c 140bp C57BL/6J, DBA/2J
d 142bp AKR/J, BALB/cJ, C3H/HeJ, NOD/MrkTac, NON/ShiLt
e 168bp CAST/EiJ
f 170bp SPRET/EiJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D18Mit150 c 140bp CBA/CaOlaHsd
s 129bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory