About   Help   FAQ
D5Mit210 Primer Detail
Primers
  • Name
    D5Mit210
  • Primer 1 Sequence
    GATGGGTGCATTCATCCTG
  • Primer 2 Sequence
    TGAAAGTGATTCCTCAGGGG
  • ID
    MGI:703095
  • Product Size
    279
  • Other IDs
    D5Mit210 (BROAD)
  • Note
    MIT assay: MT2598
    Additional information: MIT STS Marker Data Files
Genes
D5Mit210a DNA segment, Chr 5, Massachusetts Institute of Technology 210a
D5Mit210b DNA segment, Chr 5, Massachusetts Institute of Technology 210b
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D5Mit210a a 194bp C57BL/6J
b 198bp NOD/MrkTac
c 206bp A/J, AKR/J, BALB/cJ, C3H/HeJ, DBA/2J, LP/J, NON/ShiLt
d 218bp SPRET/EiJ
e 230bp CAST/EiJ
f 234bp B6.Cg-Lepob/+
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D5Mit210a c 225bp CBA/CaOlaHsd
s 216bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory