D6Mit102 Primer Detail MGI Mouse MGI:703085

D6Mit102 Primer Detail

Name

D6Mit102
Primer 1 Sequence

CCATGTGGATATCTTCCCTTG
Primer 2 Sequence

GTATACCCAGTTGTAAATCTTGTGTG
ID

MGI:703085
Product Size

145
Other IDs

D6Mit102 (BROAD)
Note

MIT assay: MPC2527
Additional information: MIT STS Marker Data Files

D6Mit102

DNA segment, Chr 6, Massachusetts Institute of Technology 102

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D6Mit102	a	126bp	C3H/HeJ, NOD/MrkTac, SPRET/EiJ
	b	140bp	A/J, BALB/cJ
	c	144bp	AKR/J
	d	146bp	B6.Cg-Lep^ob/+, C57BL/6J
	e	160bp	CAST/EiJ
	f	172bp	DBA/2J
	g	174bp	LP/J, NON/ShiLt

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D6Mit102	a	141bp	AKR/OlaHsd
	b	145bp	C57BL/6JOlaHsd, C57BL/10
	c	135bp	A/JOlaHsd, BALB/cJ
	d	171bp	DBA/2J
	g	177bp	129P3/J
	j	125bp	C3H/HeJ, JF1
	l	147bp	SJL/J
	p	149bp	PWB

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 10/07/2025 MGI 6.24