About   Help   FAQ
D6Mit102 Primer Detail
Primers
  • Name
    D6Mit102
  • Primer 1 Sequence
    CCATGTGGATATCTTCCCTTG
  • Primer 2 Sequence
    GTATACCCAGTTGTAAATCTTGTGTG
  • ID
    MGI:703085
  • Product Size
    145
  • Other IDs
    D6Mit102 (BROAD)
  • Note
    MIT assay: MPC2527
    Additional information: MIT STS Marker Data Files
Genes
D6Mit102 DNA segment, Chr 6, Massachusetts Institute of Technology 102
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D6Mit102 a 126bp C3H/HeJ, NOD/MrkTac, SPRET/EiJ
b 140bp A/J, BALB/cJ
c 144bp AKR/J
d 146bp B6.Cg-Lepob/+, C57BL/6J
e 160bp CAST/EiJ
f 172bp DBA/2J
g 174bp LP/J, NON/ShiLt
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D6Mit102 a 141bp AKR/OlaHsd
b 145bp C57BL/6JOlaHsd, C57BL/10
c 135bp A/JOlaHsd, BALB/cJ
d 171bp DBA/2J
g 177bp 129P3/J
j 125bp C3H/HeJ, JF1
l 147bp SJL/J
p 149bp PWB
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory