About   Help   FAQ
D6Mit104 Primer Detail
Primers
  • Name
    D6Mit104
  • Primer 1 Sequence
    CTCCAAATGCATGTGGACAC
  • Primer 2 Sequence
    CATCCCTCATGCCTCTGC
  • ID
    MGI:703079
  • Product Size
    144
  • Other IDs
    D6Mit104 (BROAD)
  • Note
    MIT assay: MPC2468
    Additional information: MIT STS Marker Data Files
Genes
D6Mit104 DNA segment, Chr 6, Massachusetts Institute of Technology 104
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D6Mit104 a 146bp 129X1/Sv
f 146, 154bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D6Mit104 a 122bp SPRET/EiJ
b 146bp B6.Cg-Lepob/+, C57BL/6J, LP/J, NOD/MrkTac, NON/ShiLt
c 154bp A/J, BALB/cJ, DBA/2J
d 158bp AKR/J, C3H/HeJ
e 162bp CAST/EiJ
J:156851 Golas A, MGI Direct Data Submission. 2010;
Endonuclease Gene Allele Fragments Strains
D6Mit104 b upper C57BL/6J
s lower 129/Sv
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
J:156851 Golas A, Microsatellite differences on Chromosome 3, 6, 11 and 12 in C57BL/6J and 129/Sv strains and Mapping in CBXE RI line. MGI Direct Data Submission. 2010;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory