About   Help   FAQ
D14Mit30 Primer Detail
Primers
  • Name
    D14Mit30
  • Primer 1 Sequence
    ATTTGGTGTTGAGGCCATGT
  • Primer 2 Sequence
    CTTTGTCCTTTGTCATCAAAAGG
  • ID
    MGI:703031
  • Product Size
    153
  • Note
    MIT assay: A777
Genes
D14Mit30 DNA segment, Chr 14, Massachusetts Institute of Technology 30
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D14Mit30 a 116bp 129X1/Sv
f 134bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D14Mit30 a 116bp C3H/HeJ, DBA/2J, LP/J
b 134bp NON/ShiLt
c 142bp SPRET/EiJ
d 146bp A/J, AKR/J, NOD/MrkTac
e 150bp B6.Cg-Lepob/+, BALB/cJ, C57BL/6J
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory