About   Help   FAQ
D14Mit39 Primer Detail
Primers
  • Name
    D14Mit39
  • Primer 1 Sequence
    AAAGAGCAACCCCCAATTCT
  • Primer 2 Sequence
    ACTTTTACCTGGTCTCCAAAAGC
  • ID
    MGI:703024
  • Product Size
    246
  • Other IDs
    D14Mit39 (BROAD)
  • Note
    MIT assay: A877
    Additional information: MIT STS Marker Data Files
Genes
D14Mit39 DNA segment, Chr 14, Massachusetts Institute of Technology 39
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D14Mit39 c 232bp C3HeB/FeJLe
f larger FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D14Mit39 a 232bp C3H/HeJ, DBA/2J, LP/J
b 246bp A/J, AKR/J, B6.Cg-Lepob/+, BALB/cJ, C57BL/6J, NOD/MrkTac, NON/ShiLt
c 260bp SPRET/EiJ
d 268bp CAST/EiJ
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D14Mit39 a 246bp A.CA/W, AKR/W, BALB/cW, BN/aW, C57BL/6W, C57BL/10W, CBA/W
B 232bp 129/SvW, C3H/W, DBA/2W
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory