D14Mit39 Primer Detail MGI Mouse MGI:703024

D14Mit39 Primer Detail

Name

D14Mit39
Primer 1 Sequence

AAAGAGCAACCCCCAATTCT
Primer 2 Sequence

ACTTTTACCTGGTCTCCAAAAGC
ID

MGI:703024
Product Size

246
Other IDs

D14Mit39 (BROAD)
Note

MIT assay: A877
Additional information: MIT STS Marker Data Files

D14Mit39

DNA segment, Chr 14, Massachusetts Institute of Technology 39

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D14Mit39	c	232bp	C3HeB/FeJLe
	D14Mit39	f	larger	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D14Mit39	a	232bp	C3H/HeJ, DBA/2J, LP/J
	b	246bp	A/J, AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J, NOD/MrkTac, NON/ShiLt
	c	260bp	SPRET/EiJ
	d	268bp	CAST/EiJ

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Endonuclease	Gene	Allele	Fragments	Strains
	D14Mit39	a	246bp	A.CA/W, AKR/W, BALB/cW, BN/aW, C57BL/6W, C57BL/10W, CBA/W
	D14Mit39	B	232bp	129/SvW, C3H/W, DBA/2W

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24