About   Help   FAQ
D8Mit155 Primer Detail
Primers
  • Name
    D8Mit155
  • Primer 1 Sequence
    TTGGACAGGGAAAATTCTGC
  • Primer 2 Sequence
    TGAGGACTTGCTTTAAGAGTACTCC
  • ID
    MGI:703020
  • Product Size
    150
  • Other IDs
    D8Mit155 (BROAD)
  • Note
    MIT assay: MT516
    Additional information: MIT STS Marker Data Files
Genes
D8Mit155 DNA segment, Chr 8, Massachusetts Institute of Technology 155
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D8Mit155 a 75bp SPRET/EiJ
b 87bp CAST/EiJ
c 115bp C57BL/6J
d 139bp BALB/cJ
e 147bp NOD/MrkTac
f 151bp A/J, AKR/J, B6.Cg-Lepob/+, C3H/HeJ, DBA/2J, LP/J, NON/ShiLt
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D8Mit155 c 143bp CBA/CaOlaHsd
s 132bp SWR/OlaHsd
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D8Mit155 a 151bp 129/SvW, A.CA/W, AKR/W, BN/aW, C3H/W, C57BL/6W, C57BL/10W, CBA/W, DBA/2W
b 139bp BALB/cW
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory