About   Help   FAQ
D2Mit102 Primer Detail
Primers
  • Name
    D2Mit102
  • Primer 1 Sequence
    TATTTCCCTGTCACTCCTCCC
  • Primer 2 Sequence
    TGTCTTTATGCTCAGACATACACA
  • ID
    MGI:703000
  • Product Size
    163
  • Other IDs
    D2Mit102 (BROAD)
  • Note
    MIT assay: MPC198
    Additional information: MIT STS Marker Data Files
Genes
D2Mit102 DNA segment, Chr 2, Massachusetts Institute of Technology 102
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D2Mit102 a 138bp AKR/J, NOD/MrkTac, NON/ShiLt
b 162bp B6.Cg-Lepob/+, C57BL/6J, LP/J
c 180bp C3H/HeJ, SPRET/EiJ
d 200bp A/J, BALB/cJ, DBA/2J
e 216bp CAST/EiJ
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D2Mit102 a 200bp A.CA/W, BALB/cW, DBA/2W
b 180bp C3H/W, CBA/W
c 162bp C57BL/6W, C57BL/10W
d 138bp 129/SvW, AKR/W, BN/aW
J:104037 Grzmil P, et al., MGI Direct Data Submission. 2006;
Endonuclease Gene Allele Fragments Strains
D2Mit102 c loser CBA/Kw
k upper KE
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:104037 Grzmil P, et al., Mapping of mouse Chromosome 2, 11 STS markers in CBXE and EXCB RI strains. MGI Direct Data Submission. 2006;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory