About   Help   FAQ
D17Mit244 Primer Detail
Primers
  • Name
    D17Mit244
  • Primer 1 Sequence
    GAAAATGCTAATTCAGGTATTGACA
  • Primer 2 Sequence
    CAGCCTTCATCATTCTTTCTCC
  • ID
    MGI:702981
  • Product Size
    122
  • Other IDs
    D17Mit244 (BROAD)
  • Note
    MIT assay: MTH900
    Additional information: MIT STS Marker Data Files
Genes
D17Mit244 DNA Segment, Chr 17, Massachusetts Institute of Technology 244
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D17Mit244 a 124bp A/J, B6.Cg-Lepob/+, BALB/cJ, C57BL/6J, NOD/MrkTac
b 146bp SPRET/EiJ
c 148bp AKR/J, C3H/HeJ, DBA/2J, LP/J, NON/ShiLt
J:66472 Matsune K, J Oral Sci. 2000 Mar;42(1):21-6
Endonuclease Gene Allele Fragments Strains
D17Mit244 b smaller C57BL/6J
l larger C57L/J
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D17Mit244 a 148bp AKR/W, BN/aW, C3H/W, CBA/W, DBA/2W
b 124bp 129/SvW, A.CA/W, BALB/cW, C57BL/6W, C57BL/10W
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:66472 Matsune K, Molecular genetic study of the gutter shaped root (GSR) on mouse chromosome 17. J Oral Sci. 2000 Mar;42(1):21-6
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/09/2025
MGI 6.24
The Jackson Laboratory