D17Mit244 Primer Detail MGI Mouse MGI:702981

D17Mit244 Primer Detail

Name

D17Mit244
Primer 1 Sequence

GAAAATGCTAATTCAGGTATTGACA
Primer 2 Sequence

CAGCCTTCATCATTCTTTCTCC
ID

MGI:702981
Product Size

122
Other IDs

D17Mit244 (BROAD)
Note

MIT assay: MTH900
Additional information: MIT STS Marker Data Files

DNA Segment, Chr 17, Massachusetts Institute of Technology 244

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D17Mit244	a	124bp	A/J, B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J, NOD/MrkTac
	b	146bp	SPRET/EiJ
	c	148bp	AKR/J, C3H/HeJ, DBA/2J, LP/J, NON/ShiLt

J:66472 Matsune K, J Oral Sci. 2000 Mar;42(1):21-6

Endonuclease	Gene	Allele	Fragments	Strains
	D17Mit244	b	smaller	C57BL/6J
	D17Mit244	l	larger	C57L/J

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Endonuclease	Gene	Allele	Fragments	Strains
	D17Mit244	a	148bp	AKR/W, BN/aW, C3H/W, CBA/W, DBA/2W
	D17Mit244	b	124bp	129/SvW, A.CA/W, BALB/cW, C57BL/6W, C57BL/10W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:66472 Matsune K, Molecular genetic study of the gutter shaped root (GSR) on mouse chromosome 17. J Oral Sci. 2000 Mar;42(1):21-6

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/16/2024 MGI 6.23