About   Help   FAQ
D17Mit245 Primer Detail
Primers
  • Name
    D17Mit245
  • Primer 1 Sequence
    TGTGCTCTGGCTAGGGAGTT
  • Primer 2 Sequence
    CACATTCATATGTACACACACATGC
  • ID
    MGI:702980
  • Product Size
    200
  • Other IDs
    D17Mit245 (BROAD)
  • Note
    MIT assay: MTH1769
    Additional information: MIT STS Marker Data Files
Genes
D17Mit245 DNA segment, Chr 17, Massachusetts Institute of Technology 245
Polymorphisms
J:46489 You Y, et al., Mamm Genome. 1998 Mar;9(3):232-4
Notes: Data for C57BL/6J and BALB/cJ strains was derived from the Whitehead Institute/MIT genome center website.
Endonuclease Gene Allele Fragments Strains
Not Specified D17Mit245 b 202bp C57BL/6J
c 198bp C57BL/6J
s 192bp 129X1/SvJ
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D17Mit245 a 196bp NON/ShiLt
b 198bp AKR/J, BALB/cJ, LP/J, SPRET/EiJ
c 200bp DBA/2J
d 202bp B6.Cg-Lepob/+, C57BL/6J
e 204bp CAST/EiJ
f 212bp NOD/MrkTac
References
J:46489 You Y, et al., Utility of C57BL/6J x 129/SvJae embryonic stem cells for generating chromosomal deletions: tolerance to gamma radiation and microsatellite polymorphism. Mamm Genome. 1998 Mar;9(3):232-4
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/16/2026
MGI 6.24
The Jackson Laboratory