About   Help   FAQ
D6Mit259 Primer Detail
Primers
  • Name
    D6Mit259
  • Primer 1 Sequence
    ACAGGCACTGCACTCACATC
  • Primer 2 Sequence
    GCTGAACTCTGTTGTTGCCA
  • ID
    MGI:702975
  • Product Size
    116
  • Other IDs
    D6Mit259 (BROAD)
  • Note
    MIT assay: MT3720
    Additional information: MIT STS Marker Data Files
Genes
D6Mit259 DNA segment, Chr 6, Massachusetts Institute of Technology 259
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D6Mit259 a 92bp SPRET/EiJ
b 100bp NOD/MrkTac, NON/ShiLt
c 118bp A/J, AKR/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J
d 122bp LP/J
e 138bp CAST/EiJ
J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3
Endonuclease Gene Allele Fragments Strains
D6Mit259 c smaller C58/J
f not given FVB/NJ
i not given I/LnJ
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory