About   Help   FAQ
D19Mit23 Primer Detail
Primers
  • Name
    D19Mit23
  • Primer 1 Sequence
    CCATTTCCTTTGAGGATAGTGT
  • Primer 2 Sequence
    AAATCTTGGCATTTCTCTTACTGG
  • ID
    MGI:702963
  • Product Size
    193
  • Other IDs
    D19Mit23 (BROAD)
  • Note
    MIT assay: B440
    Additional information: MIT STS Marker Data Files
Genes
D19Mit23 DNA segment, Chr 19, Massachusetts Institute of Technology 23
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D19Mit23 a 186bp 129P2/Ola, 129P3/J, 129T1/Sv-Dnd1Ter, 129X1/Sv
b 180bp 129X1/SvJ
c 186, 196bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D19Mit23 a 186bp A/J, AKR/J, BALB/cJ, NOD/MrkTac, NON/ShiLt
b 196bp B6.Cg-Lepob/+, C3H/HeJ, C57BL/6J, DBA/2J, LP/J
c 204bp CAST/EiJ, SPRET/EiJ
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D19Mit23 l larger LG/J
s smaller SM/J
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory