About   Help   FAQ
D17Mit117 Primer Detail
Primers
  • Name
    D17Mit117
  • Primer 1 Sequence
    AGTCCATTTATCGGGGGC
  • Primer 2 Sequence
    TTTAATGGCACATCTGGCAA
  • ID
    MGI:702950
  • Product Size
    122
  • Other IDs
    D17Mit117 (BROAD)
  • Note
    MIT assay: MT558
    Additional information: MIT STS Marker Data Files
Genes
D17Mit117 DNA segment, Chr 17, Massachusetts Institute of Technology 117
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D17Mit117 a 117bp SPRET/EiJ
b 121bp CAST/EiJ
c 123bp C57BL/6J
d 125bp B6.Cg-Lepob/+
e 127bp A/J, AKR/J, BALB/cJ, C3H/HeJ, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D17Mit117 c 142bp CBA/CaOlaHsd
s 136bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory