About   Help   FAQ
D17Mit114 Primer Detail
Primers
  • Name
    D17Mit114
  • Primer 1 Sequence
    GGATCCTTAGGGCTCACACA
  • Primer 2 Sequence
    GCCTATTTTCCAATTTGGCA
  • ID
    MGI:702949
  • Product Size
    150
  • Other IDs
    D17Mit114 (BROAD)
  • Note
    MIT assay: MT535
    Additional information: MIT STS Marker Data Files
Genes
D17Mit114 DNA segment, Chr 17, Massachusetts Institute of Technology 114
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D17Mit114 a 125bp CAST/EiJ
b 131bp NOD/MrkTac, NON/ShiLt
c 147bp C3H/HeJ
d 151bp A/J, AKR/J, B6.Cg-Lepob/+, BALB/cJ, C57BL/6J, DBA/2J, LP/J
e 161bp SPRET/EiJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D17Mit114 c 142bp CBA/CaOlaHsd
s 140bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/22/2025
MGI 6.24
The Jackson Laboratory